D. J.:

- Added the leetcode problem and solution for 187

Author: nobodyPerfecZ

README.md

@@ -182,6 +182,7 @@
 - [169 Majority Element](https://leetcode.com/problems/majority-element/description/)
 - [172 Factorial Trailing Zeroes](https://leetcode.com/problems/factorial-trailing-zeroes/description/)
 - [173 Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator/description/)
+- [187 Repeated DNA Sequences](https://leetcode.com/problems/repeated-dna-sequences/description/)
 - [188 Best Time to Buy and Sell Stock IV](https://leetcode.com/problems/best-time-to-buy-and-sell-stock-iv/description/)
 - [189 Rotate Array](https://leetcode.com/problems/rotate-array/description/)
 - [190 Reverse Bits](https://leetcode.com/problems/reverse-bits/description/)

awesome_python_leetcode/_187_repeated_dna_sequences.py

@@ -0,0 +1,24 @@
+import collections
+from typing import List
+
+
+class Solution:
+    """Base class for all LeetCode Problems."""
+
+    def findRepeatedDnaSequences(self, s: str) -> List[str]:
+        """
+        The DNA sequence is composed of a series of nucleotides abbreviated
+        as 'A', 'C', 'G', and 'T'.
+
+        For example, "ACGAATTCCG" is a DNA sequence.
+        When studying DNA, it is useful to identify repeated sequences within the DNA.
+
+        Given a string s that represents a DNA sequence, return all the 10-letter-long
+        sequences (substrings) that occur more than once in a DNA molecule. You may
+        return the answer in any order.
+        """
+        count = collections.defaultdict(int)
+        for i in range(len(s) - 9):
+            sequence = s[i : i + 10]
+            count[sequence] += 1
+        return list(filter(lambda key: count[key] >= 2, count.keys()))

tests/test_187_repeated_dna_sequences.py

@@ -0,0 +1,18 @@
+from typing import List
+
+import pytest
+
+from awesome_python_leetcode._187_repeated_dna_sequences import Solution
+
+
+@pytest.mark.parametrize(
+    argnames=["s", "expected"],
+    argvalues=[
+        ("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", ["AAAAACCCCC", "CCCCCAAAAA"]),
+        ("AAAAAAAAAAAAA", ["AAAAAAAAAA"]),
+    ],
+)
+def test_func(s: str, expected: List[str]):
+    """Tests the solution of a LeetCode problem."""
+    dna_sequences = Solution().findRepeatedDnaSequences(s)
+    assert dna_sequences == expected